View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20393_low_5 (Length: 340)
Name: NF20393_low_5
Description: NF20393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20393_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 192 - 321
Target Start/End: Original strand, 34848016 - 34848145
Alignment:
| Q |
192 |
aagattaaccattgatgatagagcctctattggttatctttcagatggtctcatagttcgtacacaagaaaggaaaaaaggtacatatattctaatatat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
34848016 |
aagattaaccattgatgatagagcctctattggttatctttcagatggtctcatagttcgtacacaagaaaggaaaaaaggtacatatattgtaatacat |
34848115 |
T |
 |
| Q |
292 |
ttgtgaatttttaatttagattcaaatttt |
321 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |
|
|
| T |
34848116 |
ttgtaaatttttaatttagattcaaatttt |
34848145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 15 - 143
Target Start/End: Original strand, 34847839 - 34847967
Alignment:
| Q |
15 |
cataggtcataattcaaggacatgtaattcattaagaggaagtagtagttttgttggagttagactttttggtgttcaacttgatttatcttcttcttgt |
114 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34847839 |
cataggtcataattcaaggacttgtaattcattaagaggaagtggtagttttgttggagttagactttttggtgttcaacttgatttatcttcttcttgt |
34847938 |
T |
 |
| Q |
115 |
gtgtccatgaaaaagagttttagcatgga |
143 |
Q |
| |
|
|| |||||||||||||||||||||||||| |
|
|
| T |
34847939 |
gtttccatgaaaaagagttttagcatgga |
34847967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University