View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20393_low_6 (Length: 329)
Name: NF20393_low_6
Description: NF20393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20393_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 62 - 306
Target Start/End: Complemental strand, 31420618 - 31420374
Alignment:
| Q |
62 |
taagtagaagaaatttacaagtttggttttgcttccactttcagaaactgcaggagttgaatttccagaactagtctcttgaaaatccatcatttttctc |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31420618 |
taagtagaagaaatttacaagtttggttttgcttccactttcagaaactgcaggagttgaatttccagaactagtctcttgaaaatccatcatttttctc |
31420519 |
T |
 |
| Q |
162 |
tttttaccttcatgatgaactttattttcttcttgaaaaattgttggaagtgaaagttgaactgcattgtgattttgattattgacatgatggacaagac |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31420518 |
tttttaccttcatgatgaactttattttcttcttgaaaaattgttggaagtgaaagttgaactgcattgtgattttgattattgacatgatggacaagac |
31420419 |
T |
 |
| Q |
262 |
catgaaaattctcttccaagtttcttggaaacacatgttcttgtt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31420418 |
catgaaaattctcttccaagtttcttggaaacacatgttcttgtt |
31420374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University