View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20394_low_3 (Length: 250)

Name: NF20394_low_3
Description: NF20394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20394_low_3
NF20394_low_3
[»] chr1 (1 HSPs)
chr1 (16-180)||(8167379-8167543)


Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 16 - 180
Target Start/End: Complemental strand, 8167543 - 8167379
Alignment:
16 atagcatttagtaaaaccccgttccaattnnnnnnnnttatcattttttaacggttaacaaaaaattacaattttaatgggtgccttattaatgatgtaa 115  Q
    |||||||||| |||||||| |||||||||        ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8167543 atagcatttaataaaaccctgttccaattaaaaaaaattaccattttttaacggttaacaaaaaattacaattttaatgggtgccttattaatgatgtaa 8167444  T
116 gcaaaattttatttaaaaaggtaccataacaaaaataaacccagaataataacttcatataaaga 180  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
8167443 gcaaaattttatttaaaaaggtaccataacaaaaataaatccagaataataacttcatataaaga 8167379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University