View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20394_low_8 (Length: 237)
Name: NF20394_low_8
Description: NF20394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20394_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 40265021 - 40264800
Alignment:
| Q |
1 |
ttgttaatatcaatcatttgttgtgctcaaacccctttttatgcaaaagtaattttttaactgtatgatcaggcctctagagatggtgacgggactgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40265021 |
ttgttaatatcaatcatttgttgtgctcaaacccctttttatgcaaaagtaattttttaactgtatgatcaggcctctagagatggtgacgggactgttc |
40264922 |
T |
 |
| Q |
101 |
gaattcagagacctcccaaaggaccattttatgtttcccgcaaaacgattgatgaacagattgcagatcttacatatttcgcgaggttgctttactgcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40264921 |
gaattcagagacctcccaaaggaccattttatgtttcccgcaaaacgattgatgaacagattgcagatcttacatatttcgcgaggttgctttactgcct |
40264822 |
T |
 |
| Q |
201 |
agtttcttattctgtgttttgt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40264821 |
agtttcttattctgtgttttgt |
40264800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 52 - 158
Target Start/End: Complemental strand, 40283819 - 40283713
Alignment:
| Q |
52 |
attttttaactgtatgatcaggcctctagagatggtgacgggactgttcgaattcagagacctcccaaaggaccattttatgtttcccgcaaaacgattg |
151 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||| ||||||||||| ||||||||||||| ||||||||||| || ||||| |||||| |
|
|
| T |
40283819 |
attttttaactgtatgatcaggcctctaaagatgatgacgggaccattcgaattcagcgacctcccaaagggccattttatgtctctagcaaagcgattg |
40283720 |
T |
 |
| Q |
152 |
atgaaca |
158 |
Q |
| |
|
||||||| |
|
|
| T |
40283719 |
atgaaca |
40283713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 62 - 165
Target Start/End: Complemental strand, 40291277 - 40291174
Alignment:
| Q |
62 |
tgtatgatcaggcctctagagatggtgacgggactgttcgaattcagagacctcccaaaggaccattttatgtttcccgcaaaacgattgatgaacagat |
161 |
Q |
| |
|
|||||||||||||||||| ||||| ||| ||||| ||||||||||| |||||| ||||| ||||||||||| || ||||||||||||||||| | || |
|
|
| T |
40291277 |
tgtatgatcaggcctctaaagatgatgatgggaccgttcgaattcaacgacctcttaaagggccattttatgtctctggcaaaacgattgatgaaaacat |
40291178 |
T |
 |
| Q |
162 |
tgca |
165 |
Q |
| |
|
|||| |
|
|
| T |
40291177 |
tgca |
40291174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University