View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20395_high_24 (Length: 238)
Name: NF20395_high_24
Description: NF20395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20395_high_24 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 9302139 - 9301919
Alignment:
| Q |
18 |
agaagaaaggtgaattgatgtgattatgtgttgtttacggacaaataaataaggtggtagtaaagtgtaaacatcgtcacctcttcattgccaagttgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9302139 |
agaagaaaggtgaattgatgtgattatgtgttgtttacggacaaataaataaggtggtagtaaagtgtaaacatcgtcacctcttcattgccaagttgtt |
9302040 |
T |
|
| Q |
118 |
tgatcaacttcaaggagcctagtgtttttccaagatagaattgcagtctgggtatcaccagttgaagattaagagggatcatatgccagtgtcaacgttt |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9302039 |
tgatcaacttcaaggagcttagtgtttttccaagatagaattgcagtctgggtatcaccagttgaagattaagagggatcatatgccagtgtcaacgttt |
9301940 |
T |
|
| Q |
218 |
tgcacatgctgcgagcattat |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9301939 |
tgcacatgctgcgagcattat |
9301919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 156 - 238
Target Start/End: Complemental strand, 12406573 - 12406491
Alignment:
| Q |
156 |
aattgcagtctgggtatcaccagttgaagattaagagggatcatatgccagtgtcaacgttttgcacatgctgcgagcattat |
238 |
Q |
| |
|
||||||||| ||||||||||||||| |||| |||||||||||||||| || || ||||||||||||||||||||||||||||| |
|
|
| T |
12406573 |
aattgcagtatgggtatcaccagttaaagactaagagggatcatatgtcaatgccaacgttttgcacatgctgcgagcattat |
12406491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 111 - 192
Target Start/End: Original strand, 27687248 - 27687329
Alignment:
| Q |
111 |
agttgtttgatcaacttcaaggagcctagtgtttttccaagatagaattgcagtctgggtatcaccagttgaagattaagag |
192 |
Q |
| |
|
|||||||||| ||||||||||||||| | |||||||| ||||| || || | ||||||||||||||| |||||||||||||| |
|
|
| T |
27687248 |
agttgtttgaccaacttcaaggagcccaatgtttttctaagattgacttacggtctgggtatcaccaattgaagattaagag |
27687329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University