View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20395_low_12 (Length: 353)
Name: NF20395_low_12
Description: NF20395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20395_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 13 - 334
Target Start/End: Original strand, 12584990 - 12585311
Alignment:
| Q |
13 |
cagagctaatgttcagacatttacttctttgataaaaggttttttcgtgcaagggagagtaggtgatgctgttggtttgtggaatctcatgatccgagag |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12584990 |
cagacctaatgttcagacatttacttctttgataaaaggttttttcgtgcgagggagagtaggtgatgctgttggtttgtggaatctcatgatccgagag |
12585089 |
T |
|
| Q |
113 |
ggagttagtccaaatgtcgtcgcatacaacactctcatacatggtctttgctccgatgggaatatggatgaagcaatatctgtatggaataagatggaga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12585090 |
ggagttagtccaaatgtcgtcgcatacaacactctcatacatggtctttgctccgatgggaatatggatgaagcaatatctgtatggaatcagatggaga |
12585189 |
T |
|
| Q |
213 |
aagattctatccgtccgaacgtgaccacatatagcactatcatatatggttttgcaaaatcgggggatttggttagtgcttgtgaaacatggaacaagat |
312 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12585190 |
aagattctattcgtccgaacgtgaccacatatagcactatcatatatggttttgcaaaatcgggggatttggttagtgcttgtgaaacatggaacaagat |
12585289 |
T |
|
| Q |
313 |
gataaattgtggttgccgtcca |
334 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12585290 |
gataaattgtggttgccgtcca |
12585311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University