View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20395_low_16 (Length: 318)
Name: NF20395_low_16
Description: NF20395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20395_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 19 - 311
Target Start/End: Complemental strand, 6896290 - 6895999
Alignment:
| Q |
19 |
gttatgatgcaattgttatgtaatatatctcatcattctgcattgaataccgtataggnnnnnnnnttaatattttagaatgataaactagtattagaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
6896290 |
gttatgatgcaattgttatgtaatatatctcatcattctgcgttgaataccgtataggaaaaaaa-ttaacattttagaatgataaactagtattagaaa |
6896192 |
T |
 |
| Q |
119 |
gttgttggattnnnnnnnntaaacttttgccactttctaatgcatattgatgagtatttgctttaggtccaatttctgtccagtataacaattcctctgc |
218 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6896191 |
gttgttggagtaaaaaaaataaacttttgccactttctaatgcatattgatgagtatttgctttaggtccaatttctgtccagtataacaattcctctac |
6896092 |
T |
 |
| Q |
219 |
ttgttcaacacttagcgaaaccggtggaaagagtgcggaaggtatcatcttgtcatctgcagggagtcgggattttactttgccttcttctca |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6896091 |
ttgttcaacacttagcgaaaccggtggaaagagtacggaaggtatcatcttgtcatctgcagggagtcgggattttactttgccttcttctca |
6895999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University