View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20395_low_20 (Length: 264)
Name: NF20395_low_20
Description: NF20395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20395_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 259
Target Start/End: Original strand, 368898 - 369140
Alignment:
| Q |
17 |
acctataaagatcgtttgtttgatctaaatctcctcatgatttgtctacaactgtccattgagatagttgtccaagttacggttttggatcataaaacca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
368898 |
acctataaagatcgtttgtttgatctaaatctcctcatgatttgtctacaactgtccattgagatagttgtccaagttacagttttggatcataaaacca |
368997 |
T |
 |
| Q |
117 |
taatcgtcccactataaagctttgctcatagtataggcttaggtacactcttttttaatctaaaacctcacaacattcatgatgttctttaaggatggag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
368998 |
taatcgtcccactataaagctttgctcatagtataggcttaggtacactcttttttaatctaaaacctcacaacattcatgatgttctttaaggatggag |
369097 |
T |
 |
| Q |
217 |
catattttatggatttgactgttattattgttttcttctctct |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
369098 |
catattttatggatttgactgttattattgtcttcttatctct |
369140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University