View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20395_low_24 (Length: 243)
Name: NF20395_low_24
Description: NF20395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20395_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 21 - 232
Target Start/End: Original strand, 25595577 - 25595788
Alignment:
| Q |
21 |
ttgccttatctgattttgttgcaagtttttatctttcccaaattcaaacgaaagatggctccaaaaggggaaattttatgtagtgatttgaattgcattg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25595577 |
ttgccttatctgattttgttgcaagtttttatctttcccaaattcaaacgaaagatggctccaaaaggggaaattttatgtagtgatttgaattgcattg |
25595676 |
T |
 |
| Q |
121 |
ctagctaagctgattgcacatttcaattttatcaggttctcggggttgataaaagtgctagtcaacgagaaattcagaaggcttttcacaagtatgttta |
220 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25595677 |
ctagctaagctgattgtacatttcaattttatcaggttctcggggttgataaaagtgctagtcaacgagaaattcagaaggcttttcacaagtatgttta |
25595776 |
T |
 |
| Q |
221 |
ctttgcattctt |
232 |
Q |
| |
|
|||||||||||| |
|
|
| T |
25595777 |
ctttgcattctt |
25595788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University