View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20395_low_25 (Length: 239)
Name: NF20395_low_25
Description: NF20395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20395_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 5218790 - 5219014
Alignment:
| Q |
1 |
tgtgaggttgagaaactttgctgccgggcgcacacacaccgaacgacggcttcaccagttaatgtatgccgacagggactacgagggctgtcgtgcctgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5218790 |
tgtgaggttgagaaactttgctgccgggcgcacacacaccgaacgacggcttcaccagttaatgtatgccgacagggactacgagggctgtcgcgcctgt |
5218889 |
T |
|
| Q |
101 |
cacggagacagtagcggcgatcacaaaaaggggtgtgatgggactcatgtgtctattagtagatgcaaggacagggggtattgggtggtgaacttggtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5218890 |
cacggagacagtagcggcgatcacaaaaaggggtgtgatgggactcatgtgtctattagtagatgcaaggacagggggtattgggtggtgaacttggtgt |
5218989 |
T |
|
| Q |
201 |
gtagggaccgtcccaagttgttttt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5218990 |
gtagggaccgtcccaagttgttttt |
5219014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University