View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20396_high_13 (Length: 225)
Name: NF20396_high_13
Description: NF20396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20396_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 49684970 - 49684765
Alignment:
| Q |
1 |
ccgaaaatgaaccgccaaataaccaacaagtactagcaattcaacagcttgaacttgttcagtaatgcgttgtttttcttttcttattaagaaagtgcaa |
100 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49684970 |
ccgaaaaagaaccgccaaataatcaacaagtactagcaattcaacggcttgaacttgttcagtaatgcattgtttttcttttcttattaagaaagtgcaa |
49684871 |
T |
|
| Q |
101 |
aactatgtatatcgtttttcatcttttaaaactaattccagtagtttcagtttctgatcaaattaagttaaagccaaaaccctaaagctattatcatcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49684870 |
aactatgtatatcgtttttcatcttttaaaactaattccagtagtttcagtttctgatcaaattaagttaaagccaaaaccctaaagctattatcatcac |
49684771 |
T |
|
| Q |
201 |
caacag |
206 |
Q |
| |
|
|||||| |
|
|
| T |
49684770 |
caacag |
49684765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University