View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20396_high_7 (Length: 253)
Name: NF20396_high_7
Description: NF20396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20396_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 37637387 - 37637145
Alignment:
| Q |
1 |
tggttgggatcttgctagtcttgtgactgcaggtccaggt---gctacttcagcggattcaggaacaatacggttgtccaggctggcatgagtgcgatga |
97 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37637387 |
tggttgggatcttgcaagtcttgtgactgcaggtccaggttcagctacttcagcggattcaggaacaatacggctgtccaggctggcatgagtgcgatga |
37637288 |
T |
 |
| Q |
98 |
ggttcaggggaagctggttgagatcttgcaagtcttgtgactacaggtccagattcagctacttcagcggattcaggaagaatgcggctgtccgggccat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37637287 |
ggttcaggggaagctggttgagatcttgcaagtcttgtgactacaggtccagattcagctacttcagcggattcaggaagaatgcggctgtccgggccat |
37637188 |
T |
 |
| Q |
198 |
acaagcacagtcctgctctcatagataatctgcccatctgtgc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37637187 |
acaagcacagtcctgctctcatagataatctgcccatctgtgc |
37637145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 92 - 190
Target Start/End: Complemental strand, 37637407 - 37637309
Alignment:
| Q |
92 |
cgatgaggttcaggggaagctggttgagatcttgcaagtcttgtgactacaggtccagattcagctacttcagcggattcaggaagaatgcggctgtcc |
190 |
Q |
| |
|
|||||||||||||| |||| |||||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
37637407 |
cgatgaggttcaggcgaagttggttgggatcttgcaagtcttgtgactgcaggtccaggttcagctacttcagcggattcaggaacaatacggctgtcc |
37637309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 92 - 149
Target Start/End: Complemental strand, 37646816 - 37646759
Alignment:
| Q |
92 |
cgatgaggttcaggggaagctggttgagatcttgcaagtcttgtgactacaggtccag |
149 |
Q |
| |
|
|||||||||||||| |||| |||||| ||||| |||||||||| || ||||| ||||| |
|
|
| T |
37646816 |
cgatgaggttcaggcgaagttggttgggatctagcaagtcttgcgattacagctccag |
37646759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University