View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20397_low_13 (Length: 262)
Name: NF20397_low_13
Description: NF20397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20397_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 9 - 254
Target Start/End: Complemental strand, 5726634 - 5726376
Alignment:
| Q |
9 |
taaatgataagatcaaaggacgtgcgagaaaatagtagactggaaaaagcatttctttaatttaattaagatattaacatatgccgacataatgaagcat |
108 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5726634 |
taaatgattagatcaaaggaggtgcgagaaaatagtagactgaaaaaagcatttctttaatttaattaagatattaacatatgccgacataatgaagcat |
5726535 |
T |
 |
| Q |
109 |
aaaatttagagttaatttttgcacccttaacttcttagtttttccttagcaaacaaataatgt--------------ctcgtagagattccttttgagtt |
194 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| | | |||||||||||||||||| |
|
|
| T |
5726534 |
aaaatttagagttaatttttgcaaccttaacttcttagtttttccttagc-aacaaataatgtaacatctacgagcaattgcagagattccttttgagtt |
5726436 |
T |
 |
| Q |
195 |
aattgatatcattttatgatattgacatattcgggtatatatttttcatatgcacaggtt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5726435 |
aattgatatcattttatgatattgacatattcgggtatatatttttcatatgcacaggtt |
5726376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University