View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20398_high_25 (Length: 322)
Name: NF20398_high_25
Description: NF20398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20398_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 7e-46; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 16 - 134
Target Start/End: Complemental strand, 40385355 - 40385237
Alignment:
| Q |
16 |
atgtaaaggactgcaggcagacataattttgattgagttgtgttcaaagctaaacgcataaaagtaataatgtaaggtgcatataatctcgnnnnnnnac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40385355 |
atgtaaaggactgcaggcagacataattttgattgagttgtgttcaaagctaaacgcataaaagtaataatgtaaggtgcatataatctcgttttttttc |
40385256 |
T |
 |
| Q |
116 |
tatttctttcaagctaaca |
134 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40385255 |
tatttctttcaagctaaca |
40385237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 239 - 297
Target Start/End: Complemental strand, 40385189 - 40385131
Alignment:
| Q |
239 |
attttagagaaatgctgctgcatgcaacaaatatatttttcagaaaagaccacgatagc |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40385189 |
attttagagaaatgctgctgcatgcaacaaatatatttttcagaaaagaccacgatagc |
40385131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 170 - 220
Target Start/End: Complemental strand, 40385235 - 40385185
Alignment:
| Q |
170 |
tgttgtgaaaatggaaattaaaacatgaaaaagtaatagttacacaatttt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40385235 |
tgttgtgaaaatggaaattaaaacatgaaaaagtaatagttacacaatttt |
40385185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University