View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20398_high_30 (Length: 292)
Name: NF20398_high_30
Description: NF20398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20398_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 20 - 228
Target Start/End: Complemental strand, 47078194 - 47077986
Alignment:
| Q |
20 |
accttcactgcattatgaggtcgcgtgctttcaacttttgttgcnnnnnnnatttcccagtttaccctttttcaacggtcctatacaactgtactcctat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47078194 |
accttcactgcattatgaggtcgcgtgctttcaacttttgttgctttttttctttcccagtttaccctttttcaacggtcctatacaactgtactcctat |
47078095 |
T |
 |
| Q |
120 |
tcccgcaaaaaagatgcggcttttgctgtatcaaatttaccatcttacccacgccaacttttgattaatctctgttttttatgttaattaattactagta |
219 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47078094 |
tcccgcaaaaaagatgcggcttttgttgtatcaaatttaccatcttacccacgccaacttttgattaatctctgttttttatgttaattaattactagta |
47077995 |
T |
 |
| Q |
220 |
actgtttgc |
228 |
Q |
| |
|
||||||||| |
|
|
| T |
47077994 |
actgtttgc |
47077986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University