View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20398_high_42 (Length: 214)

Name: NF20398_high_42
Description: NF20398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20398_high_42
NF20398_high_42
[»] chr3 (1 HSPs)
chr3 (17-196)||(46353387-46353566)


Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 46353387 - 46353566
Alignment:
17 aatattggatagcaagtacaaaattgtttttaacatgtataattgaccatgttgagtaggacctaatcctccttagttaacactaattagcaatgacgat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46353387 aatattggatagcaagtacaaaattgtttttaacatgtataattgaccatgttgagtaggacctaatcctccttagttaacactaattagcaatgacgat 46353486  T
117 tacaatgtaaattgctgatttgacaagaagtaataataagtagattgtaagtaacccttcgaaaattggacattatattt 196  Q
    ||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
46353487 tacaatgtaaattactgatttgacaacaagtaataataagtagattgtaagtaacccttcgaaaattggacattatattt 46353566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University