View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20398_high_42 (Length: 214)
Name: NF20398_high_42
Description: NF20398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20398_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 46353387 - 46353566
Alignment:
| Q |
17 |
aatattggatagcaagtacaaaattgtttttaacatgtataattgaccatgttgagtaggacctaatcctccttagttaacactaattagcaatgacgat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46353387 |
aatattggatagcaagtacaaaattgtttttaacatgtataattgaccatgttgagtaggacctaatcctccttagttaacactaattagcaatgacgat |
46353486 |
T |
 |
| Q |
117 |
tacaatgtaaattgctgatttgacaagaagtaataataagtagattgtaagtaacccttcgaaaattggacattatattt |
196 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46353487 |
tacaatgtaaattactgatttgacaacaagtaataataagtagattgtaagtaacccttcgaaaattggacattatattt |
46353566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University