View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20398_low_30 (Length: 295)
Name: NF20398_low_30
Description: NF20398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20398_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 148 - 285
Target Start/End: Complemental strand, 44708290 - 44708153
Alignment:
| Q |
148 |
gatttttacgtgttcctaaatatggatctagttattattattgtattctatatatgtcgtgattttcttgttttttacgaagcttgttgagaaattcttc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44708290 |
gatttttacgtgttcctaaatatggatctagttattattattgcattctatatatgtcgtgattttcttgttttttacgaagcttgttgagaaattcttc |
44708191 |
T |
|
| Q |
248 |
aaatacatacactcaatatgtttttacatgtcattcat |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44708190 |
aaatacatacactcaatatgtttttacatgtcattcat |
44708153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 44708421 - 44708354
Alignment:
| Q |
18 |
actatcccattctctctccattgcttgttgctactatttcgtatctgacaaacattcatgtcggtatg |
85 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44708421 |
actatcccattatctctccattgcttgttgctactatttcgtatctgacaaaacttcatgtcggtatg |
44708354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University