View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20398_low_31 (Length: 292)

Name: NF20398_low_31
Description: NF20398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20398_low_31
NF20398_low_31
[»] chr3 (1 HSPs)
chr3 (20-228)||(47077986-47078194)


Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 20 - 228
Target Start/End: Complemental strand, 47078194 - 47077986
Alignment:
20 accttcactgcattatgaggtcgcgtgctttcaacttttgttgcnnnnnnnatttcccagtttaccctttttcaacggtcctatacaactgtactcctat 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||    
47078194 accttcactgcattatgaggtcgcgtgctttcaacttttgttgctttttttctttcccagtttaccctttttcaacggtcctatacaactgtactcctat 47078095  T
120 tcccgcaaaaaagatgcggcttttgctgtatcaaatttaccatcttacccacgccaacttttgattaatctctgttttttatgttaattaattactagta 219  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47078094 tcccgcaaaaaagatgcggcttttgttgtatcaaatttaccatcttacccacgccaacttttgattaatctctgttttttatgttaattaattactagta 47077995  T
220 actgtttgc 228  Q
    |||||||||    
47077994 actgtttgc 47077986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University