View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20398_low_42 (Length: 231)
Name: NF20398_low_42
Description: NF20398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20398_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 215
Target Start/End: Original strand, 42726005 - 42726201
Alignment:
| Q |
19 |
gtcttttgtatgagttggagactaaaaccctcctcagtaagtttccaggtagattcatttagacaccctttcctgccctacaaaaggtgaactggtttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42726005 |
gtcttttgtatgagttggagactaaaaccctcctcagtaagtttccaggtagattcatttagacaccctttcctgccctacaaaaggtgaactgatttgt |
42726104 |
T |
 |
| Q |
119 |
tttagttcaagtacatgttggagacacgagcataattatagaggttgttgggctatgatattttcatgttctaatacaaacaactcttctcagatat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42726105 |
tttagttcaagtacatgttggagacacgagcataattatagtggttgttgggctatgatattttcatgttctaatacaaacaactcttctcaaatat |
42726201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University