View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20399_high_6 (Length: 211)
Name: NF20399_high_6
Description: NF20399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20399_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 44449093 - 44449270
Alignment:
| Q |
18 |
attaatttgtttgaattgttcttcatttactgttttgcatgtactttcttcactatcagactctattatctaaattaatactctattagtttgttgcttt |
117 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44449093 |
attaatttgtttgaattcttctccatttactgttttgcatgtactttcttcactatcagacactgttatctaaattaatactctattagtttgttgcttt |
44449192 |
T |
|
| Q |
118 |
agtgatgataaatttgttttatattatttattacttttggatagttggattagcaaagactgattataaactttgaag |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44449193 |
agtgatgataaatttgttttatattatttattacttttggatagttggattagcaaagactgattataaactttgaag |
44449270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University