View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2039_high_11 (Length: 259)
Name: NF2039_high_11
Description: NF2039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2039_high_11 |
 |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0018 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 66 - 180
Target Start/End: Complemental strand, 156493 - 156375
Alignment:
| Q |
66 |
agctgacacctgtcggtgtctgatacca----gtgtaagacatccgaagttattatccgtgtctacgggtcagagtgtcagtgtcgtgtcctgcatccat |
161 |
Q |
| |
|
|||| |||||||||||||||| |||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
156493 |
agcttacacctgtcggtgtctaataccaacaggtgtaagacatcctaagttattatccgtgtctacaggtcagagtgtcagtgtcgtgtcctgcatccat |
156394 |
T |
 |
| Q |
162 |
tattgtgattcatattcat |
180 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
156393 |
tattgtgattcatattcat |
156375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 145 - 180
Target Start/End: Complemental strand, 41504813 - 41504778
Alignment:
| Q |
145 |
tcgtgtcctgcatccattattgtgattcatattcat |
180 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41504813 |
tcgtgtcgtgcatccattattgtgattcatattcat |
41504778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University