View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2039_low_13 (Length: 270)
Name: NF2039_low_13
Description: NF2039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2039_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 11 - 253
Target Start/End: Complemental strand, 35602226 - 35601984
Alignment:
| Q |
11 |
caaaggctgctgctgcaaagtgggtaatgggctatctataaatatctgggaagataggtggctcccctatcaaaatggattcaaagtcatcaccccaagc |
110 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35602226 |
caaaggctactgctgaaaagtgggtaatgggctatctataaacatctgggaagataggtggctcccctatcaaaatggattcaaagtcatcaccccaagc |
35602127 |
T |
|
| Q |
111 |
tctagggactctaacattcacatggtcaaagatcttttaataggctctccaccagattggaataaaaaactcatagaggatacttttatcccttttgaag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35602126 |
tctagggactctaacattcacatggtcaaagatcttttaataggctctccaccagattggaataaaaaactcatagaggatacttttatcccttttgaag |
35602027 |
T |
|
| Q |
211 |
ggattcaaatccaacaactccccctaatcgataaggagaatca |
253 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35602026 |
ggattcaaatccaacaactccccctaaccgataaggagaatca |
35601984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University