View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2039_low_14 (Length: 259)

Name: NF2039_low_14
Description: NF2039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2039_low_14
NF2039_low_14
[»] scaffold0018 (1 HSPs)
scaffold0018 (66-180)||(156375-156493)
[»] chr1 (1 HSPs)
chr1 (145-180)||(41504778-41504813)


Alignment Details
Target: scaffold0018 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 66 - 180
Target Start/End: Complemental strand, 156493 - 156375
Alignment:
66 agctgacacctgtcggtgtctgatacca----gtgtaagacatccgaagttattatccgtgtctacgggtcagagtgtcagtgtcgtgtcctgcatccat 161  Q
    |||| |||||||||||||||| ||||||    ||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||    
156493 agcttacacctgtcggtgtctaataccaacaggtgtaagacatcctaagttattatccgtgtctacaggtcagagtgtcagtgtcgtgtcctgcatccat 156394  T
162 tattgtgattcatattcat 180  Q
    |||||||||||||||||||    
156393 tattgtgattcatattcat 156375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 145 - 180
Target Start/End: Complemental strand, 41504813 - 41504778
Alignment:
145 tcgtgtcctgcatccattattgtgattcatattcat 180  Q
    ||||||| ||||||||||||||||||||||||||||    
41504813 tcgtgtcgtgcatccattattgtgattcatattcat 41504778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University