View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2039_low_17 (Length: 250)
Name: NF2039_low_17
Description: NF2039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2039_low_17 |
 |  |
|
| [»] scaffold0027 (3 HSPs) |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0027 (Bit Score: 171; Significance: 6e-92; HSPs: 3)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 64 - 250
Target Start/End: Complemental strand, 20971 - 20785
Alignment:
| Q |
64 |
aatagtatcaactcttatgactccaaatttgatgttgtgcactgtttctaggatattactggtgtgtttggaataatggtagattttgtacaaacacacg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20971 |
aatagtatcaactcttatgactccaaatttgatgttgtgcactgtttctaggatattactggtgtgtttggaatagtggtagattttgtacaaacacacg |
20872 |
T |
 |
| Q |
164 |
tctagctcgatcctacaattcattgtttctttagattcacgttttacttgcatatgaacgcgaggatatatgaccaaacgccaatcc |
250 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20871 |
tctagctcaatcctacaattcattgtttctttaaattcacgttttacttgcatatggacgcgaggatatatgaccaaacgccaatcc |
20785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 45
Target Start/End: Complemental strand, 21064 - 21029
Alignment:
| Q |
10 |
attatactctttcatttcttaaaaaaattatttcta |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
21064 |
attatactctttcatttcttaaaaaaattatttcta |
21029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 11 - 45
Target Start/End: Complemental strand, 21024 - 20990
Alignment:
| Q |
11 |
ttatactctttcatttcttaaaaaaattatttcta |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
21024 |
ttatactctttcatttcttaaaaaaattatttcta |
20990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 123 - 250
Target Start/End: Original strand, 6392805 - 6392932
Alignment:
| Q |
123 |
tggtgtgtttggaataatggtagattttgtacaaacacacgtctagctcgatcctacaattcattgtttctttagattcacgttttacttgcatatgaac |
222 |
Q |
| |
|
|||||||||||||| || ||| |||||| |||||| | |||||||||||||||||||||| | | ||||||| |||||| ||||||||||||| || |
|
|
| T |
6392805 |
tggtgtgtttggaacaacggtggattttccacaaacgcgcgtctagctcgatcctacaatttttggcttctttaaattcactttttacttgcatagcgac |
6392904 |
T |
 |
| Q |
223 |
gcgaggatatatgaccaaacgccaatcc |
250 |
Q |
| |
|
||||| ||||||| ||| |||||||||| |
|
|
| T |
6392905 |
gcgagaatatatggccacacgccaatcc |
6392932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 198 - 250
Target Start/End: Complemental strand, 7574817 - 7574765
Alignment:
| Q |
198 |
attcacgttttacttgcatatgaacgcgaggatatatgaccaaacgccaatcc |
250 |
Q |
| |
|
||||| |||||||||||||| || ||||| |||||||||||||||||||||| |
|
|
| T |
7574817 |
attcaagttttacttgcatagaaatgcgagaatatatgaccaaacgccaatcc |
7574765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University