View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20402_high_14 (Length: 296)
Name: NF20402_high_14
Description: NF20402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20402_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 156 - 280
Target Start/End: Original strand, 31753416 - 31753540
Alignment:
| Q |
156 |
cagtttcaccccattttgactggtataaaacagttgatgtctggcttggtttttaaaacattggtcgatacaaccactgatcatactttatttaccactc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31753416 |
cagtttcaccccattttgactggtataaaacagttgatgtctggcttggtttttaaaacattggtcgatacaaccactgatcatactttatttaccactc |
31753515 |
T |
 |
| Q |
256 |
gacgacattctcccttactcagaaa |
280 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
31753516 |
gacgacattctcccttactcagaaa |
31753540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 31753242 - 31753367
Alignment:
| Q |
1 |
gttagacttaaatgtttatgtgtttcagccaagttcaaattattttggtagtctctgagttcgatttctagttgaaaccaatgttttgaaaatcaaacca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31753242 |
gttagacttaaatgtttatgtgtttcagccaagttcaaattattttggtagtctctgagttcgatttctagttgaaaccaatgttttgaaaattaaacca |
31753341 |
T |
 |
| Q |
101 |
aaccggactagacggttcaactggtt |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31753342 |
aaccggactagacggttcaactggtt |
31753367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 161
Target Start/End: Original strand, 31753355 - 31753393
Alignment:
| Q |
123 |
ggttcaactggttgaaccgtggactagaactgtcagttt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31753355 |
ggttcaactggttgaaccgtggactagaactgtccgttt |
31753393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University