View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20402_high_21 (Length: 249)
Name: NF20402_high_21
Description: NF20402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20402_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 31753133 - 31752895
Alignment:
| Q |
1 |
cattagaaactttatgcggccaaacctatggtgctgaagaattcagcaaaattggaaactacatttgcagtgcaatgatcaccttgattttggtctgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31753133 |
cattagaaactttatgcggccaaacctatggtgctgaagaattcagcaaaattggaaactacatttgcagtgcaatgatcaccttgattttggtctgttt |
31753034 |
T |
|
| Q |
101 |
ccccatatcactcatgtggatattcattgataaattactcttgcttttcggtcaagacattgagattgctcaagcagctcgagaatactgcatatgcttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31753033 |
ccccatatcactcatgtggatattcattgataaattactcttgcttttcggtcaagacattgagattgctcaagcagctcgagaatactgcatatgcttg |
31752934 |
T |
|
| Q |
201 |
atcccagcactttttggccatgctgttcttcaatctctg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31752933 |
atcccagcactttttggccatgctgttcttcaatctctg |
31752895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University