View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20402_high_23 (Length: 245)
Name: NF20402_high_23
Description: NF20402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20402_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 131 - 238
Target Start/End: Original strand, 11396214 - 11396321
Alignment:
| Q |
131 |
gtggaaaatgtgataggaggcagaacaatgtatcgaatggattgcatgcgatgtcgcaacatcgatcacaaccgtctcagcagtcattttctcagggact |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11396214 |
gtggaaaatgtgataggaggcagaacaatgtatcgaatggattgcatgcgatgtcgcaacatcgatcacaaccgtctcagcagtcattttctcagggact |
11396313 |
T |
 |
| Q |
231 |
ttcatctc |
238 |
Q |
| |
|
|||||||| |
|
|
| T |
11396314 |
ttcatctc |
11396321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 3 - 100
Target Start/End: Original strand, 11396086 - 11396183
Alignment:
| Q |
3 |
cttatttaaagttgaatcatgtgtttcagttcaaattcaggtgcttcttttttgagtatgcggttttaggtttctgtaactggatgaatatttatgaa |
100 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11396086 |
cttatttatagtcgaatcatgtgtttcagttcaaattcacgtgcttcttttttgagtatgcagttttaggtttctgtaactggatgaatatttatgaa |
11396183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University