View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20402_high_29 (Length: 208)
Name: NF20402_high_29
Description: NF20402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20402_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 56 - 190
Target Start/End: Complemental strand, 38449079 - 38448945
Alignment:
| Q |
56 |
catgcttcctcaacatctcgattcatcaatttttctaatataacttcagcaataggagcaacttgatattgcaacaatgctgcaccaaaggtcctatcaa |
155 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38449079 |
catgcttcctcaacatctcgattcatccatttttctaatataacttcagcaataggagcaacttgatattgcaacaatgctgcaccaaaggtcctatcaa |
38448980 |
T |
 |
| Q |
156 |
gttcaaccttttagtagcagatactgtccctaact |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38448979 |
gttcaaccttttagtagcagatactgtccctaact |
38448945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 56 - 179
Target Start/End: Complemental strand, 38440691 - 38440567
Alignment:
| Q |
56 |
catgcttcctcaacatctcgattcatcaatttttctaatataacttcagcaataggagcaacttgatattgcaacaatgctgcaccaa-aggtcctatca |
154 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
38440691 |
catgcttcctcaacatcacgattcatccatttttctaatataacttcagcaataggagcaacttgatgttgcaacaatgctgcaccaaggggtcctatca |
38440592 |
T |
 |
| Q |
155 |
agttcaaccttttagtagcagatac |
179 |
Q |
| |
|
||||||||||| ||| ||||||||| |
|
|
| T |
38440591 |
agttcaaccttgtagcagcagatac |
38440567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 13 - 49
Target Start/End: Complemental strand, 38449148 - 38449112
Alignment:
| Q |
13 |
agatgaaaacagtcttgaaaacaagtaaccatggcaa |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38449148 |
agatgaaaacagtcttgaaaacaagtaaccatggcaa |
38449112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 45
Target Start/End: Complemental strand, 38440761 - 38440729
Alignment:
| Q |
13 |
agatgaaaacagtcttgaaaacaagtaaccatg |
45 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
38440761 |
agatgaaaacaatcttgaaaacaagtaaccatg |
38440729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University