View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20402_low_13 (Length: 310)
Name: NF20402_low_13
Description: NF20402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20402_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 33 - 294
Target Start/End: Original strand, 47731459 - 47731721
Alignment:
| Q |
33 |
tatacaatatgaattataatggccagcaagctttttatacgacccctttactgtgttaaaaagacaaacacaacatatagatatatattaaagatacaaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
47731459 |
tatacaatatgaattataatggccagcaagctttttatacgacccctttactgtgttaaaaagacaaacacaacatatggatatatgttaaagatacaaa |
47731558 |
T |
 |
| Q |
133 |
tacaacactttgatctactaaagtgttnnnnnnngttaattgtttctagcattacacaatttgatttcgttttcttcaaacgattatattcatatgtaag |
232 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
47731559 |
tacaacactttgatctactaaagtgttaaaaaaagttaattgtttttagcattacacaatttgatttcgttttcttcaaacgattacattcatctgtaag |
47731658 |
T |
 |
| Q |
233 |
ttttgttaattaccccctataagatggtgattgga-cccttgttatatttgggtatcgactga |
294 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
47731659 |
ttttgttaattatcccctataagatggtggttggaccccttgttatatttgggtatcgactga |
47731721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University