View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20402_low_25 (Length: 245)

Name: NF20402_low_25
Description: NF20402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20402_low_25
NF20402_low_25
[»] chr8 (2 HSPs)
chr8 (131-238)||(11396214-11396321)
chr8 (3-100)||(11396086-11396183)


Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 131 - 238
Target Start/End: Original strand, 11396214 - 11396321
Alignment:
131 gtggaaaatgtgataggaggcagaacaatgtatcgaatggattgcatgcgatgtcgcaacatcgatcacaaccgtctcagcagtcattttctcagggact 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11396214 gtggaaaatgtgataggaggcagaacaatgtatcgaatggattgcatgcgatgtcgcaacatcgatcacaaccgtctcagcagtcattttctcagggact 11396313  T
231 ttcatctc 238  Q
    ||||||||    
11396314 ttcatctc 11396321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 3 - 100
Target Start/End: Original strand, 11396086 - 11396183
Alignment:
3 cttatttaaagttgaatcatgtgtttcagttcaaattcaggtgcttcttttttgagtatgcggttttaggtttctgtaactggatgaatatttatgaa 100  Q
    |||||||| ||| |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
11396086 cttatttatagtcgaatcatgtgtttcagttcaaattcacgtgcttcttttttgagtatgcagttttaggtttctgtaactggatgaatatttatgaa 11396183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University