View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20403_low_4 (Length: 255)
Name: NF20403_low_4
Description: NF20403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20403_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 9 - 145
Target Start/End: Original strand, 22080447 - 22080583
Alignment:
| Q |
9 |
atcatcaaaaacaaaatagaaatgcagttcaatagatctttgatatgtctttgattaaaatgacttctgaaacaattttagttcgaaaaattgatttaat |
108 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
22080447 |
atcatcaaatacaaaacagaaatgcagttcaatagatctttgatacgtctttcattaaaatgacttctcaaacaattttagttcgaaaaactgatttaat |
22080546 |
T |
|
| Q |
109 |
gcaagaaggaaaaccgatctattgaaatgttgttcac |
145 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||| |
|
|
| T |
22080547 |
gcaagaaggaaaaccgatctatttaagtgttgttcac |
22080583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University