View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20406_high_16 (Length: 211)
Name: NF20406_high_16
Description: NF20406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20406_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 14 - 195
Target Start/End: Complemental strand, 46990394 - 46990212
Alignment:
| Q |
14 |
agaatatgtaattttgaagaaatagtgcgaagtgagagttcaataaatattttagggnnnnnnnnn-tctttccaatattattgtagtaagtatgcactc |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46990394 |
agaaaatgtaattttgaagaaatagtgcgaagtgagagttcaataaatattttagggaaaaaaaaaatctttccaatattattgtagtaagtatgcactc |
46990295 |
T |
 |
| Q |
113 |
tataattgatataaaataaactaaaagtagcactcaacagccttgggctttttctaaaaatatgttagaaaggcagatgatgt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46990294 |
tataattgatataaaataaactaaaagtagcactcaacagccttgggctttttctaaaaatatgttagaaaggcagatgatgt |
46990212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University