View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20406_low_12 (Length: 253)
Name: NF20406_low_12
Description: NF20406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20406_low_12 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 253
Target Start/End: Original strand, 24065740 - 24065980
Alignment:
| Q |
15 |
aatatatagtcagactttactaaggtaccctcccccgaaaatcagatgattatgataaaataatttagtttttgaaattttgcagacgttttcaaataaa |
114 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24065740 |
aatatatagtcagactttactaagatatcctcccccgaaaaccagatgattaagataaaataatttagtttttgaatttttgcagacgttttcaaataaa |
24065839 |
T |
 |
| Q |
115 |
tattttaccatacatgttttactaactagtatgcattaactagcttgttattc--aacnnnnnnnntaatacattctttcatccatcttgctaaaggtcg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||| |||||||||||||||||||| |
|
|
| T |
24065840 |
tattttaccatacatgttttactaactagtatgcattaactagcgtgttattcaaaaaaaaaaaaaaaatacattcttttatccatcttgctaaaggtcg |
24065939 |
T |
 |
| Q |
213 |
tatatatggtggatgatgcatgtgatagttctttacttttt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24065940 |
tatatatggtggatgatgcatgtgatagttctttacttttt |
24065980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University