View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20406_low_16 (Length: 234)
Name: NF20406_low_16
Description: NF20406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20406_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 37091320 - 37091115
Alignment:
| Q |
19 |
atgaagttatgttacaaaccaaacacctacaagaaataaacaatgaaacgc-tagctaggaagcaaaacatggttctagcaaggtaacaaggttcaaaca |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37091320 |
atgaagttatgttacaaaccaaacaactacaagaaataaacaatgaaacacctagctaggaagcaaaacatggttctagcaaggtaacaaggttcaaact |
37091221 |
T |
 |
| Q |
118 |
tcagaagaagggatttatccatcactgatgaaaatcaaagttaagtgtttgtgtttggatttcaaccaccacaaaatagaagtttcactttatcacatat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37091220 |
tcagaagaagggatttatccatcactgatgaaaatcaaagttaagtgtttgtgtttggatttcaaccaccacaaaatagaagtttcactttatcacatag |
37091121 |
T |
 |
| Q |
218 |
atgatg |
223 |
Q |
| |
|
|||||| |
|
|
| T |
37091120 |
atgatg |
37091115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University