View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20406_low_18 (Length: 211)

Name: NF20406_low_18
Description: NF20406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20406_low_18
NF20406_low_18
[»] chr7 (1 HSPs)
chr7 (14-195)||(46990212-46990394)


Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 14 - 195
Target Start/End: Complemental strand, 46990394 - 46990212
Alignment:
14 agaatatgtaattttgaagaaatagtgcgaagtgagagttcaataaatattttagggnnnnnnnnn-tctttccaatattattgtagtaagtatgcactc 112  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||    
46990394 agaaaatgtaattttgaagaaatagtgcgaagtgagagttcaataaatattttagggaaaaaaaaaatctttccaatattattgtagtaagtatgcactc 46990295  T
113 tataattgatataaaataaactaaaagtagcactcaacagccttgggctttttctaaaaatatgttagaaaggcagatgatgt 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46990294 tataattgatataaaataaactaaaagtagcactcaacagccttgggctttttctaaaaatatgttagaaaggcagatgatgt 46990212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University