View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20408_high_2 (Length: 565)
Name: NF20408_high_2
Description: NF20408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20408_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 323 - 546
Target Start/End: Complemental strand, 46481620 - 46481397
Alignment:
| Q |
323 |
caaggaaggatgattgctaaggtcctcttaggcaacctttatagatggagaaaatatattgctgcaagattgtgcattgtctcaaaaatgatacgagact |
422 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46481620 |
caaggaaggatgattgctaaggtcctcttaggcaacctttatagatggagaaaatatattgctgcaagattgtgcattgtctcaaaaatgatacgagact |
46481521 |
T |
|
| Q |
423 |
gggtttgaagatatggataatcaggggatttccttgccattcctggaacaaaacctgtttaaattcaaaatatactattgtttcatgcaattgtgattga |
522 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46481520 |
gggtttgaagatatggataatcaggggatttccttgccattcctggaacaaaacctgtttaaattcaaaatataccattgtttcatgcaattgtgattga |
46481421 |
T |
|
| Q |
523 |
aaaacaatctaaatatgtagctta |
546 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
46481420 |
aaaacaatctaaatatgtagctta |
46481397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 1e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 106 - 171
Target Start/End: Original strand, 50154818 - 50154883
Alignment:
| Q |
106 |
caagaaaataagtcttcatcttctttactttaaaagtaggggcggggaatttcaaatctctaatgg |
171 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50154818 |
caagaaaacaagtcttcatcttcttaactttaaaagtaggggcgggaaatttcaaatctctaatgg |
50154883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 169 - 208
Target Start/End: Complemental strand, 38173895 - 38173856
Alignment:
| Q |
169 |
tgggcgaagcggagataaaggtgcttctataaagctaaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38173895 |
tgggcgaagcggagataaaggtgcttctataaagctaaat |
38173856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University