View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20408_high_43 (Length: 230)

Name: NF20408_high_43
Description: NF20408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20408_high_43
NF20408_high_43
[»] chr6 (1 HSPs)
chr6 (18-216)||(33177065-33177264)


Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 33177264 - 33177065
Alignment:
18 tatctcttaacg-ttttagtacacaagttattgttaagtgaaaatcatacgggtctcaacactttatgtgggacatgtttacagggtcatgctaaccctg 116  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
33177264 tatctcttaacgcttttagtacacaagttattgttaagtgaaaatcatacgggtctcaacactttatgtgggacatgtttacagggtcatgctaaccccg 33177165  T
117 taaatttcatcaaattagagagtacatgttgaaaataaattattacattgggtatgttgctagccctcatcaacatgaaatttatgatgtgaacgttgat 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
33177164 taaatttcatcaaattagagagtacatgttgaaaataaattattacattggggatgttgctagccctcatcaacatgaaatttatgatgtgaacgttgat 33177065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University