View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20408_low_21 (Length: 390)
Name: NF20408_low_21
Description: NF20408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20408_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 1 - 371
Target Start/End: Complemental strand, 38831581 - 38831211
Alignment:
| Q |
1 |
caaagagaaatggaggagaatttatcaattgagacatgtgactttgctgatctttccgaaggaaacttattggaaagcatcaatttcgaattcgatgatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831581 |
caaagagaaatggaggagaatttatcaattgagacatgtgactttgctgatctttccgaagggaacttattggaaagcatcaatttcgaattcgatgatg |
38831482 |
T |
 |
| Q |
101 |
atttcttcgtatgtttcaacgacggagatgtgttaccggatcttgagatggacccggaaatgcttgctgaattctccctcagcagcagcggtgaggaatc |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831481 |
atttcttcgtatgcttcaacgacggagatgtgttaccggatcttgagatggacccggaaatgcttgctgaattctccctcagcagcagcggtgaggaatc |
38831382 |
T |
 |
| Q |
201 |
ggatataaattcgtcgggtgcaaatagcaaatcttgtaatgatgggaatatggttagtattgagagaaaattacaagatgaagagaaagtagtttattct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831381 |
ggatataaattcgtcgggtgcaaatagcaaatcttgtaatgatgggaatatggttagtattgagagaaaattacaagatgaagagaaagtagtttattct |
38831282 |
T |
 |
| Q |
301 |
tcagattcaagttcgagtcgtgtggaagagataattagcaaaagagatgaatccgttgtgccgaatccatt |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831281 |
tcagattcaagttcgagtcgtgtggaagagataattagcaaaagagatgaatccgttgtgccgaatccatt |
38831211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 38 - 89
Target Start/End: Original strand, 30463872 - 30463923
Alignment:
| Q |
38 |
gtgactttgctgatctttccgaaggaaacttattggaaagcatcaatttcga |
89 |
Q |
| |
|
||||||||| || |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
30463872 |
gtgactttggcgacctttccgaaggaaatttattggaaagcatcaacttcga |
30463923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University