View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20408_low_32 (Length: 331)
Name: NF20408_low_32
Description: NF20408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20408_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 205 - 319
Target Start/End: Complemental strand, 28878522 - 28878409
Alignment:
| Q |
205 |
ccaataaatattaaatcaaaacttcattactgattacacaaacaatttacggctacaacaaagggacacacnnnnnnnnncttccttccccttcccctcc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
28878522 |
ccaataaatattaaatcaaaacttcattactgattacacaaacaatttacggctgcaacaaagggacac-ttttttttttcttccttccccttcccctcc |
28878424 |
T |
 |
| Q |
305 |
attattcgaccttca |
319 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
28878423 |
attattcgaccttca |
28878409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University