View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20408_low_41 (Length: 272)
Name: NF20408_low_41
Description: NF20408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20408_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 20 - 257
Target Start/End: Complemental strand, 46217309 - 46217072
Alignment:
| Q |
20 |
ggtggctagaaatgaagagatcaagaggctcttgattttggctgctgaggaaactgccagggttgagagagagacgttgtattcctccggtgcggtggtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46217309 |
ggtggctagaaatgaagagatcaagaggctcttgattttggctgctgaggaaactgccagggttgagagagagacgttgtattcctccggtgcggtggtt |
46217210 |
T |
|
| Q |
120 |
tccgccactaacaattatcaatgtgctctctgctattttcctgccactgcgcgctgcgccaagtgcaaatctgttcgatactggtgcgttgttctaatcg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46217209 |
tccgccactaacaattatcaatgtgctctctgctattttcctgccactgcgcgctgcgctaagtgcaaatctgttcgatactggtgcgttgttctaatcg |
46217110 |
T |
|
| Q |
220 |
attgaatttgttaaactgcgctgaacttttcaacctat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46217109 |
attgaatttgttaaactgcgctgaacttttcaacctat |
46217072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University