View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20408_low_42 (Length: 268)
Name: NF20408_low_42
Description: NF20408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20408_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 4618141 - 4617902
Alignment:
| Q |
11 |
taatactaggataatcaagggattttcactttaatcaagaaattggccttgtataattaagattgcattactatttcttctacatgtattgcctcttata |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4618141 |
taatactaggataatcaagggattttcactttaatcaagaaattggccttgtataattaggattgcattactatttcttctacatgtattgcctcttata |
4618042 |
T |
 |
| Q |
111 |
tttgtaagtgtatgatcatgttannnnnnnaagtgatcgtctaaacatggtaacaattttgttttactaatattaatttgggctataatggagtgttggg |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4618041 |
tttgtaagtgtatgatcatgttattttcttaagtgatcatctaaacatggtaacaattttgttttactaattttaatttgggctataatggagtgttggg |
4617942 |
T |
 |
| Q |
211 |
taagcttttgttttgttttgagaaatactgtttgggaaaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4617941 |
taagcttttgttttgttttgagaaatactgtttgggaaaa |
4617902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 207
Target Start/End: Original strand, 45985594 - 45985656
Alignment:
| Q |
145 |
gatcgtctaaacatggtaacaattttgttttactaatattaatttgggctataatggagtgtt |
207 |
Q |
| |
|
|||| |||||||||| ||||||| || ||||||| ||||||||||||| || |||||||||| |
|
|
| T |
45985594 |
gatcatctaaacatgataacaatctttttttacttatattaatttgggataggatggagtgtt |
45985656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 11 - 44
Target Start/End: Original strand, 45985444 - 45985477
Alignment:
| Q |
11 |
taatactaggataatcaagggattttcactttaa |
44 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
45985444 |
taatactaggatattcaagggattttcactttaa |
45985477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University