View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20408_low_45 (Length: 253)
Name: NF20408_low_45
Description: NF20408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20408_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 12957574 - 12957733
Alignment:
| Q |
1 |
tatggcattggtggtgtgtacttaggaagggctaaaggtccttattctagggtcatttttgctaagacatacctctccaaaaccattgtcccagaaggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12957574 |
tatggcattggtggtgtgtacttaggaagggctaaaggtccttattctagggtcatttttgctaagacatacctctccaaaaccattgtcccagaaggat |
12957673 |
T |
 |
| Q |
101 |
ggaccaattggagttatgatggtagcactgagtaagaacattatcatttatcaccaattc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12957674 |
ggaccaattggagttatgatggtagcactgagtaagaacattatcatttatcaccaattc |
12957733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 14241379 - 14241229
Alignment:
| Q |
1 |
tatggcattggtggtgtgtacttaggaagggctaaaggtccttattctagggtcatttttgctaagacatacctctccaaaaccattgtcccag-aagga |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||| ||||| |
|
|
| T |
14241379 |
tatggcattggtggtgtgtacttaggaagggctaaaggtccttattctagggtcatttttgctaagacatacctcttcaaaaccgttgttccagaaagga |
14241280 |
T |
 |
| Q |
100 |
tggaccaattggagttatgatggtagcactgagtaagaacattatcattta |
150 |
Q |
| |
|
|||||||||||||||||||| |||||||| || ||||| |||||||||||| |
|
|
| T |
14241279 |
tggaccaattggagttatgacggtagcacagaataagagcattatcattta |
14241229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University