View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20408_low_46 (Length: 249)
Name: NF20408_low_46
Description: NF20408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20408_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 104 - 238
Target Start/End: Complemental strand, 29580604 - 29580470
Alignment:
| Q |
104 |
acttgtattgtctcaaaaaatatgtaaaatgttaaccgagttctgcatctaggtcctactgggaaactcaattgatgatttggcggagacggtaggactt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29580604 |
acttgtattgtctcaaaaaatatgtaaaatgttaaccgagttctgcatctaggtcctactgggaaactcaattgatgatttggcggagacggtaggactt |
29580505 |
T |
 |
| Q |
204 |
gtaaccatgaggtctagagtttaaatcctgagaat |
238 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29580504 |
gtaaccatgaggtctagagttcaaatcctgagaat |
29580470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 29580707 - 29580669
Alignment:
| Q |
1 |
aaccatttgaatcctttagcttaaaatcaagtgtaggaa |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29580707 |
aaccatttgaatcctttagcttaaaatcaaatgtaggaa |
29580669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University