View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20408_low_51 (Length: 230)
Name: NF20408_low_51
Description: NF20408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20408_low_51 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 33177264 - 33177065
Alignment:
| Q |
18 |
tatctcttaacg-ttttagtacacaagttattgttaagtgaaaatcatacgggtctcaacactttatgtgggacatgtttacagggtcatgctaaccctg |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33177264 |
tatctcttaacgcttttagtacacaagttattgttaagtgaaaatcatacgggtctcaacactttatgtgggacatgtttacagggtcatgctaaccccg |
33177165 |
T |
 |
| Q |
117 |
taaatttcatcaaattagagagtacatgttgaaaataaattattacattgggtatgttgctagccctcatcaacatgaaatttatgatgtgaacgttgat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33177164 |
taaatttcatcaaattagagagtacatgttgaaaataaattattacattggggatgttgctagccctcatcaacatgaaatttatgatgtgaacgttgat |
33177065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University