View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20408_low_56 (Length: 223)
Name: NF20408_low_56
Description: NF20408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20408_low_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 36 - 208
Target Start/End: Original strand, 34844661 - 34844833
Alignment:
| Q |
36 |
attaacttgtgaatgaagctattacatttatttatcgtggttctatgagagaacatgataaactactatgaactcaatctcataggatgataactgactt |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34844661 |
attaacttgtgaatgaagctattacatttatttattgtggttctatgagagaacatgataaactactatgaactcaatctcataggatgataactgactt |
34844760 |
T |
|
| Q |
136 |
tcctacaaatatgggaagtagtttattaacttgcttaagctttgatagcttgtgttgcaagtaagtgttgtct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34844761 |
tcctacaaatatgggaagtagtttattaacttgcttaagctttgatagcttgtgttgcaagtaagtgttgtct |
34844833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 79 - 140
Target Start/End: Complemental strand, 21777014 - 21776953
Alignment:
| Q |
79 |
tatgagagaacatgataaactactatgaactcaatctcataggatgataactgactttccta |
140 |
Q |
| |
|
||||||||| ||||||| |||||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
21777014 |
tatgagagagtatgataagctactaagaactctatctcataggatgataactaactttccta |
21776953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University