View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20409_high_8 (Length: 438)
Name: NF20409_high_8
Description: NF20409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20409_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 121 - 368
Target Start/End: Original strand, 36342202 - 36342444
Alignment:
| Q |
121 |
ctgaaaattgccattctttccaagtctcctctccctccttaccctggctcacttcacttggacttgaatcctttgcagtcagttatatgattcattggat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36342202 |
ctgaaaattgccattctttccaagtctcctctccctccttaccctggctcactt-----ggacttgaatcctttgcagtcagttatatgattcattggat |
36342296 |
T |
|
| Q |
221 |
tacaatctgttggactaaagagagatnnnnnnnttctctcttttaatctatcatgatgcaaccggctgcatgataaagccggttgtagatgacccagttt |
320 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36342297 |
tacaatctgttggactaaagagagatacaaaatttctctcttttaatctatcatcatgcaaccgactgcatgataaagccggttgtagatgacccagttt |
36342396 |
T |
|
| Q |
321 |
gaccccacttctcttatagcacctatcttttagttctactttgtattg |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36342397 |
caccccacttctcttatagcacctatcttttagttctactttgtattg |
36342444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 36342027 - 36342120
Alignment:
| Q |
1 |
gattttttaacactccatactataccaaattttagatgtaatgtcactgattagaaagcatattttttaagaatgtgatatatgtaaataatgt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36342027 |
gattttttaacactccatactataccaaattttagatgtaatgtcactgattagaaagcattctttttaagaatgtgatatatgtaaataatgt |
36342120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University