View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20409_low_13 (Length: 389)
Name: NF20409_low_13
Description: NF20409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20409_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 12 - 372
Target Start/End: Complemental strand, 1239394 - 1239031
Alignment:
| Q |
12 |
aagaaaaatcgagtaaatggtcattttcgtctttgaacgtcttagttatatagnnnnnnnnnn---aatatatcaacattacaaaaacatttctaaatgt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1239394 |
aagaaaaatcgagtaaatggtcattttcgtctttgaacgtcttagttatatagttttttttttttaaatatatcaacattacaaaaacatttctaaatgt |
1239295 |
T |
|
| Q |
109 |
ttgttttaccggtgagtttggtcctcagatgcgtgctttattagttattttgatcgtctaatatcttttgttagtcagcttaattagtgcataaaaatta |
208 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1239294 |
ttgttttaccggtgagtttggtcctcggatgtgtgctttattagttattttgatcatctaatgtcttttgttagtcagcttaattagtgcatgaaaatta |
1239195 |
T |
|
| Q |
209 |
ctaacnnnnnnnttacattcagtatgcttatttgcaattttaaatacatgccgggattatagtgtcattgtttcaaacattcaaggactaaaatgacaat |
308 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
1239194 |
ctaacaaaaaaaatacattcagtatgcttatttgcaattttaaatacatgccgggattatagtgtcattgtttcagacattcaagaactaaaatgacaat |
1239095 |
T |
|
| Q |
309 |
ttgtttctaaactatgtaaacgcgtaaaattcgaacataatcattatctctttattattgggtt |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1239094 |
ttgtttctaaactatgtaaacgcgtaaaattcgaacataatcattatctctttattattgggtt |
1239031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University