View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20409_low_27 (Length: 232)
Name: NF20409_low_27
Description: NF20409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20409_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 64 - 211
Target Start/End: Complemental strand, 41689523 - 41689363
Alignment:
| Q |
64 |
gtacaacaagtgctcttgttgtcatacaatggagacaaaacaaaaaa-------------caggttgaatgcccaaattgatatctaagaggaaccttac |
150 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41689523 |
gtacaacaagtgctcttgttgtcatacaacggagacaaaaaaaaaaaaaaaaaaaaaaaacaggttgaatgcccaaattgatatctaagaggaaccttac |
41689424 |
T |
 |
| Q |
151 |
tannnnnnncgatccagattaattttttatctaatctaataaaattaaggaatatatgttt |
211 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41689423 |
tatttttttcgatccagattaattttttatctaatctaataaaattaaggaatatatgttt |
41689363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 41689587 - 41689548
Alignment:
| Q |
1 |
atatgccaaagtcaatcaaaagataacaagtgctggagtg |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41689587 |
atatgccaaagtcaatcaaaagataacaagtgcaggagtg |
41689548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University