View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20411_high_3 (Length: 345)
Name: NF20411_high_3
Description: NF20411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20411_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 324
Target Start/End: Complemental strand, 7763132 - 7762809
Alignment:
| Q |
1 |
agtttctcgtaaagcatttcatcatccatttcaacaatcgatgaatccgataaaaacccatcagcgtacttggttgctaggtcgtgaatgtaggttgctt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7763132 |
agtttctcgtaaagcatttcatcgtccatttcaacaatcgatgaatccgataaaaacccatcagcgtacttggttgctaggtcgtgaatgtaggttgctt |
7763033 |
T |
 |
| Q |
101 |
ttcgtgccgagattccaacggaacgaagagtgtccggtgtaacggataaaacggtgtttgggaggatggaacattggttggtgaagagcgagatgaagcg |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7763032 |
ttcgcgccgagattccaacggaacgaagagtgtccggtgtaacggataaaacggtgtttgggaggatggaacattggttggtgaagagcgagatgaagcg |
7762933 |
T |
 |
| Q |
201 |
ttgttcgattgaagaggatgcttttatggagagttgttgggagataagggttttgatgagagagaagaaaggtgtgatagcgtttgagtttgagaattgg |
300 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7762932 |
ttgttcgattgaagaggatgctttgatggagagttgttgggagattagggttttgatgagagagaagaaaggtgtgatagcgtttgagtttgagaattgg |
7762833 |
T |
 |
| Q |
301 |
ggtggagggaaggtgttgatgatg |
324 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7762832 |
ggtggagggaaggtgttgatgatg |
7762809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University