View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20411_low_3 (Length: 283)
Name: NF20411_low_3
Description: NF20411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20411_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 19 - 271
Target Start/End: Original strand, 2777785 - 2778037
Alignment:
| Q |
19 |
ccatccccattttgggtccgtcctctccctcagtcttcttcaccaacgaccatggcatcccccgccaaactggataaagatcaggttttctctattctca |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2777785 |
ccatccccattttgggtccttcctctccctcagtcttcttcaccaacgaccatggcatcccccgccaaactggataaagatcaggttttctctattctca |
2777884 |
T |
|
| Q |
119 |
attttgcgttattaattacacttcaattctcttttatcttcttaatctcaatcaatatcactttcactcctcctccgagtatttttcaattcaaatcgtt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2777885 |
attttgcgttattaattacacttcaattctcttttatcttcttaatctcaatcgatatcactttcactcctcctccgagtatttttcaattcaaatcgtt |
2777984 |
T |
|
| Q |
219 |
ttcttaccttcaaactgattctaactacttttttcgtattctgcacaggttct |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2777985 |
ttcttaccttcaaactgattctaactacttttttcgtattgtgcacaggttct |
2778037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University